Bookmarks for December 4th through January 10th

These are my links for December 4th through January 10th:

Content Delivery Network (CDN) using Linode VPS

This month one of the neat things I’ve done was to set up a small content delivery network (CDN) for speedy downloading of files across the globe. For one reason and another (mostly the difficulty in doing this purely with DNS and the desire not to use AWS), I opted to do this using my favourite VPS provider, Linode. All in all (and give or take DNS propagation time) I reckon it’s possible to deploy a multi-site CDN in under 30 minutes given a bit of practice. Not too shabby!

For this recipe you will need:

  1. Linode account
  2. A domain name and DNS management

What you’ll end up with:

  1. 3x Ubuntu 12.04 LTS VPS, one each in London, Tokyo and California
  2. 3x NodeBalancers, one each in London, Tokyo and California
  3. 1x user-facing general web address
  4. 3x continent-facing web addresses

I’m going to use “mycdn.com” wherever I refer to my DNS / domain. You should substitute your domain name wherever you see it.

So, firstly log in to Linode.

Create three new Linode 1024 small VPSes (or whatever size you think you’ll need). I set mine up as Ubuntu 12.04 LTS with 512MB swap but otherwise nothing special. Set one each to be in London, Tokyo and Fremont. Set the root password on each. Under “Settings”, give each VPS a label. I called mine vps-<city>-01. Under “Remote Settings”, give each a private IP and note them down together with the VPS/data centre they’re in.

At this point it’s also useful (but not strictly necessary) to give each node a DNS CNAME for its external IP address, just so you can log in to them easily by name later.

Boot all three machines and check you can login to them. I find it useful here to do an

apt-get update ; apt-get dist-upgrade.

You can also now install Apache and mod_geoip on each node:

apt-get install apache2 libapache2-mod-geoip
a2enmod include
a2enmod rewrite

You should now be able to bring up a web browser on each VPS (public IP or CNAME) in turn and see the default Apache “It works!” page.

Ok.. still with me? Next we’ll ask Linode to fire up three NodeBalancers, again one in each of the data centres, for each VPS. I labelled mine cdn-lb-<city>-01. Each one can be configured with a Port, 80 with, for now, the default settings. Add a host to each NodeBalancer with the private IP of each VPS, and the port, e.g. 192.168.128.123:80 . Note that each VPS hasn’t yet been configured to listen on those interfaces so each NodeBalancer won’t recognise its host as being up.

Ok. Let’s fix those private interfaces. SSH into each VPS using the root account and the password you set earlier. Edit /etc/network/interfaces and add:

auto eth0:1
iface eth0:1 inet static
	address <VPS private address here>
	netmask <VPS private netmask here>

Note that your private netmask is very unlikely to be 255.255.255.0 (probably) like your home network and yes, this does make a difference. Once that configuration is in, you can:

ifup eth0:1

Now we can add DNS CNAMEs for each NodeBalancer. Take the public IP for each NodeBalancer over to your DNS manager and add a meaningful CNAME for each one. I used continental regions americasapaceurope, but you might prefer to be more specific than that (e.g. us-westeu-west, …). Once the DNS propagates you should be able to see each of your Apache “It works!” pages again in your browser, but this time the traffic is running through the NodeBalancer (you might need to wait a few seconds before the NodeBalancer notices the VPS is now up).

Ok so let’s take stock. We have three VPS, each with a NodeBalancer and each running a web server. We could stop here and just present a homepage to each user telling them to manually select their local mirror – and some sites do that, but we can do a bit better.

Earlier we installed libapache2-mod-geoip. This includes a (free) database from MaxMind which maps IP address blocks to the continents they’re allocated to (via the ISP who’s bought them). The Apache module takes the database and sets a series of environment variables for each and every visitor IP. We can use this to have a good guess at roughly where a visitor is and bounce them out to the nearest of our NodeBalancers – magic!

So, let’s poke the Apache configuration a bit. rm /etc/apache2/sites-enabled/000-default. Create a new file /etc/apache2/sites-available/mirror.mycdn.com and give it the following contents:

<VirtualHost>
	ServerName mirror.mycdn.com
	ServerAlias *.mycdn.com
	ServerAdmin webmaster@mycdn.com

	DocumentRoot /mirror/htdocs

	DirectoryIndex index.shtml index.html

	GeoIPEnable     On
	GeoIPScanProxyHeaders     On

	RewriteEngine     On

	RewriteCond %{HTTP_HOST} !americas.mycdn.com
	RewriteCond %{ENV:GEOIP_CONTINENT_CODE} NA|SA
	RewriteRule (.*) http://americas.mycdn.com$1 [R=permanent,L]

	RewriteCond %{HTTP_HOST} !apac.mycdn.com
	RewriteCond %{ENV:GEOIP_CONTINENT_CODE} AS|OC
	RewriteRule (.*) http://apac.mycdn.com$1 [R=permanent,L]

	RewriteCond %{HTTP_HOST} !europe.mycdn.com
	RewriteCond %{ENV:GEOIP_CONTINENT_CODE} EU|AF
	RewriteRule (.*) http://europe.mycdn.com$1 [R=permanent,L]

	<Directory />
		Order deny,allow
		Deny from all
		Options None
	</Directory>

	<Directory /mirror/htdocs>
		Order allow,deny
		Allow from all
		Options IncludesNoExec
	</Directory>
</VirtualHost>

Now ln -s /etc/apache2/sites-available/mirror.mycdn.com /etc/apache2/sites-enabled/ .

mkdir -p /mirror/htdocs to make your new document root and add a file called index.shtml there. The contents should look something like:

<html>
 <body>
  <h1>MyCDN Test Page</h1>
  <h2><!--#echo var="HTTP_HOST" --></h2>
<!--#set var="mirror_eu"       value="http://europe.mycdn.com/" -->
<!--#set var="mirror_apac"     value="http://apac.mycdn.com/" -->
<!--#set var="mirror_americas" value="http://americas.mycdn.com/" -->

<!--#if expr="${GEOIP_CONTINENT_CODE} == AF"-->
 <!--#set var="continent" value="Africa"-->
 <!--#set var="mirror" value="${mirror_eu}"-->

<!--#elif expr="${GEOIP_CONTINENT_CODE} == AS"-->
 <!--#set var="continent" value="Asia"-->
 <!--#set var="mirror" value="${mirror_apac}"-->

<!--#elif expr="${GEOIP_CONTINENT_CODE} == EU"-->
 <!--#set var="continent" value="Europe"-->
 <!--#set var="mirror" value="${mirror_eu}"-->

<!--#elif expr="${GEOIP_CONTINENT_CODE} == NA"-->
 <!--#set var="continent" value="North America"-->
 <!--#set var="mirror" value="${mirror_americas}"-->

<!--#elif expr="${GEOIP_CONTINENT_CODE} == OC"-->
 <!--#set var="continent" value="Oceania"-->
 <!--#set var="mirror" value="${mirror_apac}"-->

<!--#elif expr="${GEOIP_CONTINENT_CODE} == SA"-->
 <!--#set var="continent" value="South America"-->
 <!--#set var="mirror" value="${mirror_americas}"-->
<!--#endif -->
<!--#if expr="${GEOIP_CONTINENT_CODE}"-->
 <p>
  You appear to be in <!--#echo var="continent"-->.
  Your nearest mirror is <a href="<!--#echo var="mirror" -->"><!--#echo var="mirror" --></a>.
 </p>
 <p>
  Or choose from one of the following:
 </p>
<!--#else -->
 <p>
  Please choose your nearest mirror:
 </p>
<!--#endif -->

<ul>
 <li><a href="<!--#echo var="mirror_eu"       -->"><!--#echo var="mirror_eu"        --></a> Europe (London)</a></li>
 <li><a href="<!--#echo var="mirror_apac"     -->"><!--#echo var="mirror_apac"      --></a> Asia/Pacific (Tokyo)</a></li>
 <li><a href="<!--#echo var="mirror_americas" -->"><!--#echo var="mirror_americas"  --></a> USA (Fremont, CA)</a></li>
</ul>

<pre style="color:#ccc;font-size:smaller">
http-x-forwarded-for=<!--#echo var="HTTP_X_FORWARDED_FOR" -->
GEOIP_CONTINENT_CODE=<!--#echo var="GEOIP_CONTINENT_CODE" -->
</pre>
 </body>
</html>

Then apachectl restart to pick up the new virtualhost and visit each one of your NodeBalancer CNAMEs in turn. The ones which aren’t local to you should redirect you out to your nearest server.

Pretty neat! The last step is to add a user-facing A record, I used mirror.mycdn.com, and set it up to DNS-RR (Round-Robin) the addresses of the three NodeBalancers. Now Set up a cron job to rsync your content to the three target VPSes, or a script to push content on-demand. Job done!

For extra points:

  1. Clone another VPS behind each NodeBalancer so that each continent is fault tolerant, meaning you can reboot one VPS in each pair without losing continental service.
  2. Explore whether it’s safe to add the public IP of one Nodebalancer to the Host configuration of a NodeBalancer on another continent, effectively making a resilient loop.

Bookmarks for November 6th through December 3rd

These are my links for November 6th through December 3rd:

Multivariate Charts from HTML tables in D3.js

For a dynamic monovariate (single line) chart, please see my earlier post – http://psyphi.net/blog/2013/04/charts-from-tables-with-d3js-and-jquery/.

Sometimes you just have to plot more than one dataset on the same chart, but you might have a complex data table with some “collections” of single-values and some collections of multiple values. Here I’ve put together an example from something I’ve been working on recently. Once your back-end queries (SQL or whatever) are written and your templates convert those data into basic HTML tables, you can plot then straight to SVG/D3 without much extra work.

Nearly all of that extra work is around adding appropriate classes to cells to distinguish columns and collections of columns. The rest is to extract those cells out again and decide which should be plotted together.

In this example, tabs and table headings belong to classes “collection_#” “a_c#” where the collection_# identifies a set of columns to be displayed together and the a_c# identifies the (links for the) columns themselves. Collections with multiple columns therefore have a single collection class but contain more than one a_c# class.

Next each table tbody td data cell belongs to a c# class, one for each column. Each one is also uniquely identified by a td#_<date> which allows hovers on the table cell to highlight the SVG data point and vice versa. Next each cell contains a span with a “val” class (more on that in the next post).

SVG paths may now be built for each column. Clicks on table-headings and tabs are able to examine which columns co-display because they belong in the same collection and then scale and plot them appropriately.

Note that the first and last tabs in this example plot single lines to demonstrate mixed collections in action. The middle two tabs have two lines each but there’s no reason why you couldn’t have more (although there are only seven colours listed at the moment).

Bookmarks for August 5th through October 14th

These are my links for August 5th through October 14th:

Cross-platform automated builds for node-webkit applications

Recently I’ve been extending my “classic” JavaScript knowledge by learning NodeJS. I’m sad to say that writing cross-platform, Desktop-class applications in Perl is just way too much hassle. However, having also discovered node-webkit I’ve been able to accelerate my desktop application development using classic HTML & CSS knowledge and improving my JavaScript techniques, mostly trying to better understand fully asynchronous, non-blocking programming. Apart from some initial mind-bending scoping experiences which maybe I’ll come back to another day, it’s generally been a breeze.

One of the useful things I’ve been able to do is to automate cross-platform application builds for Windows and Mac (Linux to come, not a priority right now but should be easy – feel free to comment). It’s not compilation, but more like application packaging.

My project has the node-webkit distributable zips in “src/”. The target folder is “dist/” and I’m also using a few DOS tools (zip.exe & unzip.exe and the commandline Anolis Resource editor) which live in dist/tools. The targets are built with timestamped filenames, a .exe in “dist/win/” for Windows and a .dmg in “dist/mac/” for OSX. I don’t do anything clever with Info.plist on Mac though I know I should, but the icons are set on both platforms, assuming they’ve been pre-generated and saved in the right places (resources/).

On OSX I’m using system make which presumably came with XCode. On Windows I’m using gmake which on my system came with a previous installation of Strawberry Perl but is also available in a Windows binary/installer.

My Makefile looks something like below (“make” not being one of my strongest skills – apologies for the ugly stuff). It might not be 100% complete as it’s been excised out of the original, much more complicated Makefile, so use with caution. If anyone has any tips on stuffing it all into NSIS automatically as well, please comment.

NW    := node-webkit-v0.7.3
NWWIN := $(NW)-win-ia32
NWMAC := $(NW)-osx-ia32
NWLIN := $(NW)-linux-x64

deps:
	rm -rf node_modules
	npm install

windeps:
	if exist node_modules rmdir node_modules /s /q
	npm install

# zip.exe &amp; unzip.exe from http://stahlworks.com/dev/?tool=zipunzip
# Resourcer.exe from http://anolis.codeplex.com/
win: windeps
	if exist mdc.nw del mdc.nw /q
	if exist dist\win rmdir dist\win /s /q
	if exist tmp rmdir tmp /s /q
	dist\tools\zip -r mdc.nw mdc package.json node_modules
	mkdir dist\win tmp
	dist\tools\unzip -d tmp -o src\$(NWWIN).zip
	dist\tools\Resourcer -op:del -src:tmp\nw.exe -type:14 -name:IDR_MAINFRAME
	dist\tools\Resourcer -op:add -src:tmp\nw.exe -type:14 -name:IDR_MAINFRAME -file:resources\mdc72x72.ico -lang:1033
	copy /b tmp\nw.exe+mdc.nw dist\win\mdc.exe
	copy tmp\icudt.dll dist\win
	copy tmp\nw.pak dist\win
	if exist mdc.nw del mdc.nw /q
	if exist tmp rmdir tmp /q /s
	dist\tools\zip -r dist\win\mdc-$(shell echo %date:~-4,4%%date:~3,2%%date:~0,2%-%time:~0,2%%time:~3,2%).zip dist\win

mac: deps
	[ ! -f mdc.nw ] || rm mdc.nw
	zip -r mdc.nw mdc package.json resources/mdc72x72.png node_modules
	touch node-webkit.app
	rm -rf node-webkit.app dist/mdc.app dist/mac
	mkdir dist/mac
	unzip -o src/$(NWMAC).zip
	mv node-webkit.app dist/mac/mdc.app
	mv mdc.nw dist/mac/mdc.app/Contents/Resources/app.nw
	rm dist/mac/mdc.app/Contents/Resources/nw.icns
	sips -s format icns resources/mdc512x512.png --out dist/mac/mdc.app/Contents/Resources/mdc.icns
	perl -i -pe 's{nw[.]icns}{mdc.icns}smxg' dist/mac/mdc.app/Contents/Info.plist
	perl -i -pe 's{node[-]webkit[ ]App}{MDC}smxg' dist/mac/mdc.app/Contents/Info.plist
	hdiutil create dist/mac/mdc-$(shell date +'%Y%m%d-%H%M').dmg -ov -volname "MDC" -fs HFS+ -srcfolder dist/mac/mdc.app
	rm -rf dist/mac/mdc.app

test:
	@./node_modules/.bin/mocha

.PHONY: test

Bookmarks for June 30th through July 2nd

These are my links for June 30th through July 2nd:

Bookmarks for June 5th through June 26th

These are my links for June 5th through June 26th:

Random Sequence Mutator

Here’s a handy one(ish)-liner to mutate an input sequence using Perl’s RegEx engine:

epiphyte:~ rmp$ perl -e '$seq="ACTAGCTACGACTAGCATCGACT"; $mutants = [qw(A C T G)];
  print "$seq\n";
  $seq =~ s{([ATGC])}{ rand() < 0.5 ? $mutants->[int rand 4] : $1 }smiexg;
  print "$seq\n";'
ACTAGCTACGACTAGCATCGACT
ACAATCGCGGACCAGAATCTCTT

This gives each base in $seq a 50% chance (rand() < 0.5) of mutating to something, but as the original base is in the available $mutants array it has a further 25% chance of changing to itself. If you wanted to improve it by excluding the original base for each mutation you might do something like:

epiphyte:~ rmp$ perl -e '$seq="ACTAGCTACGACTAGCATCGACT"; $mutants = [qw(A C T G)];
  $mutsize=scalar @{$mutants}; print "$seq\n";
  $seq =~ s{([ATGC])}{ rand() < 0.5 ? [grep { $_ ne $1 } @{$mutants}]->[int rand $mutsize-1] : $1 }smiexg;
  print "$seq\n";'
ACTAGCTACGACTAGCATCGACT
TGTAGATAATGTGATACGAGACT

This (quite inefficiently) builds an array of all available options from $mutants, excluding $1 the matched base at each position.

Unrolling it and tidying it up a little for readability looks like this:

my $seq     = 'ACTAGCTACGACTAGCATCGACT';
my $mutants = [qw(A C T G)];
my $mutsize = scalar @{$mutants};

print "$seq\n";

$seq =~ s{([ATGC])}{
   rand() < 0.5
    ?
   [grep { $_ ne $1 } @{$mutants}]->[int rand $mutsize-1]
    :
   $1
 }smiexg;

print "$seq\n";'